We narrowed to 30 results for: SPL
-
TypeCollection...ubiquitous or a tissue-specific promoter. cGAL and Split cGAL plasmids - Paul Sternberg Lab. Plasmids for...
-
COVID-19 Resources
TypeCollection...page. SARS-CoV-2 Pooled Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD mutants... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGTGTCTTCAGGTCGTTGtcaacgctggaggaatTGTGTTGCGTTCTGGTAA crispld2 TAL3232 & TAL3233 TATCAGGAGGAGCTAGAAcccaacagcactaaacCCGACGCTCCTGTCCGAA... -
Caltech Systemic Capsids
TypeCollection...strains). AAV-PHP.eC, AAV9-X1.1 and AAV1-X1 do not display strain-specific tropism and can be used in LY6A-nonpermissive... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Human Olzmann 3rd ~10 13,920 Human lncRNA Splicing-targeting CRISPR Library 119977 Knockout Human... -
Tetracycline Inducible Expression
TypeCollection...cortical neurons Michael Ward 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA Helper virus for monosynaptic tracing... -
Plan Your Experiment
TypeCollection...region is removed from the mRNA due to alternative splicing, and an early frameshift mutation is more likely... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Expression pBAD/His-B-iRFP - Bacterial Expression iSplit 690 713 5 Dimer pPAS-E - Mammalian Expression pK-GAFm... -
Validated gRNA Sequences
TypeCollection...GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens GCCCAGCCTCCGCACCTACA... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pLSC-5 62889 Mammalian/Lentiviral BsmBI yes, cut (split) S. pyogenes Zhang pICSL01009::AtU6p 46968 Plant...