We narrowed to 31 results for: rras
-
TypeCollection...Cre, or FRT for Flp). The nature of the DNA rearrangement after recombination (inversion, deletion, or...Strategies Depending on how the target sites are arranged, recombinases can be used for more than inversion...
-
Rett Syndrome
TypeCollection...developmental transcriptome information, prenatal LMD microarray data, ISH image data, and anatomic reference ..., 944–950. PMID: 21154482 Neul et al. 2019. The array of clinical phenotypes of males with mutations in... -
Bacterial Expression Systems
TypeCollection...for a B2H system used to screen the activity of arrays of zinc finger nucleases. Addgene Blog Introduction...Bacterial cells Ultrasound (acoustic reporter gene, Serratia ARG) Escherichia coli Mikhail Shapiro 78565 pCM18... -
Synthetic Biology - Overview
TypeCollection... Anastasios Melis Aindrila Mukhopadhyay Richard Murray Erin O'Shea Martin Parniske Antonio Richart Herbert... -
Viral Vector Guides and Plasmids
TypeCollection...viral production and transfer plasmids for a wide array of research purposes. Interested in Addgene's viral... -
Neurodegeneration Research Collection
TypeCollection...into neurons and more. New and Noteworthy: Study aberrant axon initial segment (AIS) plasticity with a motor... -
COVID-19 Resources
TypeCollection...expression plasmids from the Drew Endy and Philippa Marrack Labs. Point-of-care testing for COVID-19 using ... -
Immunology Research Plasmids and Resources
TypeCollection...ESRB, ESTRB, Erb, NR3A2 ESRRA estrogen-related receptor alpha ERR1, ERRa, ERRalpha, ESRL1, NR3B1 ESRRB estrogen-related... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection... kits - Construct a custom TALEN array for genomic engineering Luciferase Reporter See ... -
Luciferase Plasmid Collection
TypeCollection...promoter is present for normalization. Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion... -
Validated gRNA Sequences
TypeCollection...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285...