We narrowed to 32 results for: rras
-
TypeCollection... nucleases in different cell types. Zinc finger arrays can be transferred in-frame to these vectors.... nucleases in different cell types. Zinc finger arrays created using ZFC reagents for either OPEN or modular...
-
Zinc Finger Consortium: OPEN Reagents
TypeCollection...open-source' protocol for making customized zinc-finger arrays. Maeder ML, Thibodeau-Beganny S, Sander JD, Voytas... -
CRISPR Plasmids - Bacteria
TypeCollection...plasmid Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol yes, cut Marraffini 44251 pgRNA-bacteria... -
Cre-lox system
TypeCollection...material will be rearranged. The schematic below shows the three types of rearrangements: inversion, deletion...Cre-Lox system and how it can be used for genetic rearrangements and recombination. Use Addgene's curated tables... -
Rett Syndrome
TypeCollection...developmental transcriptome information, prenatal LMD microarray data, ISH image data, and anatomic reference ..., 944–950. PMID: 21154482 Neul et al. 2019. The array of clinical phenotypes of males with mutations in... -
Synthetic Biology - Overview
TypeCollection... Anastasios Melis Aindrila Mukhopadhyay Richard Murray Erin O'Shea Martin Parniske Antonio Richart Herbert... -
Neurodegeneration Research Collection
TypeCollection...into neurons and more. New and Noteworthy: Study aberrant axon initial segment (AIS) plasticity with a motor... -
COVID-19 Resources
TypeCollection...expression plasmids from the Drew Endy and Philippa Marrack Labs. Point-of-care testing for COVID-19 using ... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection... kits - Construct a custom TALEN array for genomic engineering Luciferase Reporter See ... -
Immunology Research Plasmids and Resources
TypeCollection...ESRB, ESTRB, Erb, NR3A2 ESRRA estrogen-related receptor alpha ERR1, ERRa, ERRalpha, ESRL1, NR3B1 ESRRB estrogen-related... -
Luciferase Plasmid Collection
TypeCollection...promoter is present for normalization Alejandro Ferrando 114670 pGL3-TK-5UTR-BsmBI-Luciferase Firefly Insertion... -
Validated gRNA Sequences
TypeCollection...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285...