...facilitate the sharing of parts and information. Addgene can help you to share your synthetic biology plasmids...

...preps that encode site-specific recombinases, which can be used to control gene expression. See our Cre-lox...

... neurons. Specific classes of projection neurons can be targeted by using this serotype to deliver Cre-dependent...lab. Results for our quality control experiments can be found on the material pages for viral catalog ...

...with dual labeling when used with two substrates Can be used in live or fixed cells, and for internal ...

... mutations in Cas9 to enhance nuclease activity; can be used in PE2–PE5 systems PE6 - small prime editors...

... a general overview of the technology and how it can be used for targeted neuronal manipulation. Topics...

...organism. All of our current pooled CRISPR libraries can be found in the following table, which also includes...species. Additional information about each library can be found on the individual library page. Find...Library 138015 Knockout Mouse Pu N/A 6 14,671 Pan-cancer CasRx lncRNA Albarossa Library 212966 Knockout ... D. melanogaster Liu N/A 3 40,279 Pan-Druggable Cancer Library 182133 Knockout Human Mali 3rd 1 74 Perturb-seq...

... at one of six hotspot residues. These mutations can be inherited or arise through exposure to mutagens... Cancer Research p53 Pathway p53 Pathway You May Also Like: Cancer Pathway ORF Kit mTOR...SDS-PAGE gel. Cancer Impact p53 is the most frequently mutated gene (>50%) in human cancer; most of these...mechanisms by which mutant p53 is known to function in cancer. p53 Pathway Plasmids Click on a name to find available...component 3 Reprimo TP53 dependent G2 arrest mediator candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2...suppression. Bieging KT, Mello SS, Attardi LD. Nat Rev Cancer. 2014 May;14(5):359-70. PubMed PMID: 24739573 ....the mutant p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097 ....

...University of Florida. References for each serotype can be found below under Citations. AAV2(Y444F) The AAV2...

...biosensors can be introduced into cells, tissues, or organisms for long-term imaging and can be designed...conditions. With proper experimental design, biosensors can enable investigation of a signaling pathway or measurement...an existing construct, as fluorescence properties can be affected by environmental factors and the sensor...1147-1155. Lin Tian Endocannabinoid GRAB_eCB2.0/eCBmut biosensor for endocannabinoids in vivo (Constitutive...peroxide Monitoring the action of redox-directed cancer therapeutics using a human peroxiredoxin-2-based...sensor for spatiotemporally resolved imaging of endocannabinoid dynamics in vivo. Nat Biotechnol. 2021 Nov ...

...fluorescent proteins under general promoters. These AAV can be used to compare the activity of different serotypes...

...Recent reports have shown that engineered TALENs can be used to induce targeted mutations with high efficiency...

...small proteins that can be secreted by immune cells and other cell types. They can be grouped in to the...cells will expand and give rise to memory cells that can recognize a recurrent infection and rapidly initiate...duration of signaling controls the fate of B cells and can lead to the formation of a high avidity BCR through...described. NK Cell Signaling Natural killer (NK) cells can kill cells that have been infected by a foreign pathogen...cytokines when cleaved from the cell membrane and can also function as signaling proteins involved in proliferation...

...Packaging Service: Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue...

... information is available for each construct and can be accessed using the links to view individual plasmid...DJ, Babyak N, Black SF, Bonaguro RJ, Brauer E, Candido TR, Castellarin M, Chen J, Chen Y, Cheng JC, Chopra...

...R-mAbs in transfected cells and their validation can be found below. With these plasmids researchers will...Antibody Plasmid Collection The following plasmids can be used to produce R-mAbs from transfected mammalian...More scFv Plasmid Collection The following plasmids can be used to produce scFvs from transfected mammalian...Nanobody Plasmid Collection The following plasmids can be used to produce nanobodies from transfected bacterial...] VGlut1 Rat Mouse IgG2a 128639 Anti-Versican [N351/23R] Versican Mouse Mouse IgG2a 128640 Anti-Pan-Ankyrin... Lgi1 Mouse Mouse IgG2a 177528 Anti-Brevican [N294A/10R] Brevican Rat Mouse IgG2a 177529 Anti-GluN1 [N308...ARHGAP4 Mouse Mouse IgG2a 190309 Anti-Brevican [N294A/6] Brevican Rat Mouse IgG2a 190311 Anti-NSD1 [N312...

...Validated gRNA Sequences Validated gRNA sequences can be added to this table from any peer reviewed publication...GCGGCAGAGAAGGAGGACCG 70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. ...

... Cancer Research mTOR Pathway mTOR Pathway You May Also Like: Cancer Pathway ORF ...poor prognosis in many cancers, including breast, colon, ovarian, and liver cancers. mTORC1 is activated...Return to top Resources Cancer Pathway ORF Kit (Sabatini & Wood) Tackling Cancers’ Drug Resistance with ...prognosis in many cancers. Cancer...ORF Kit Ras Pathway p53 Pathway Tackling Cancers’ Drug Resistance with a New Screening Kit Background mTOR...influences cell survival and cytoskeletal organization. Cancer Impact Enhanced signaling through either mTORC1...ERK, both of which are commonly dysregulated in cancer. Loss of the tumor suppressor p53 also promotes...

...carcinoid, pancreatic, and related neuroendocrine cancers. The NETRF believes that creating and maintaining... the diagnosis and treatment of neuroendocrine cancers. As such, NETRF strongly encourages its funded ...-Derived Organoids Matthew Meyerson Dana-Farber Cancer Institute Finding the Causes of Small Intestinal...Neuroendocrine Tumors Ramesh Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine...

...malaria), Toxoplasma (toxoplasmosis), Trypanosoma (African sleeping sickness), Cryptosporidium (cryptosporidiosis...