Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGWB14
Information
- Plasmid Type
- Plant Expression
- Promoter
- CaMV 35S
- Expression Level
- Unknown
- Cloning Method
- Gateway Cloning
- Size
- 17356
- 5' Sequencing 1 Primer
- M13pUC-Rev
- 5' Sequencing 1 Primer Sequence
- AGCGGATAACAATTTCACACAGG
- 5' Terminal
- C-Term
- Tag 1
- 3x HA
- Bacterial Resistance
- Kanamycin
- Selectable Marker
- Hygromycin
- Notes
- For more information about pGWB plasmids, please see: http://shimane-u.org/nakagawa/gbv.htm
- GenBank
- AB289777.1
- Stable
- Unspecified
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral