Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: ColE
Information
- Source/Vendor
- Han Lim lab
- Plasmid Type
- Bacterial Expression
- Cloning Method
- Unknown
- Size
- 2000
- 5' Sequencing 1 Primer
- Amp-R, pBR322ori-F
- 5' Sequencing 1 Primer Sequence
- ATAATACCGCGCCACATAGC, GGGAAACGCCTGGTATCTTT
- Bacterial Resistance
- Ampicillin
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified