Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: MG414
Information
- Source/Vendor
- Zinc Finger Consortium
- Plasmid Type
- Unspecified
- Cloning Method
- Unknown
- Size
- 5763
- 5' Sequencing 1 Primer
- OK.61
- 5' Sequencing 1 Primer Sequence
- GGGTAGTACGATGACGGAACCTGTC
- Bacterial Resistance
- Kanamycin
- Notes
- This vector is the backbone for the OZ-series plasmids deposited by Keith Joung and the Zinc Finger Consortium at Addgene. Inserts were cloned into this vector between XbaI (5') and BamHI (3') sites
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified