Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pAc5.1/V5-His C
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Other
- Promoter
- P-AC5 (Actin 5C)
- Cloning Method
- Unknown
- Size
- 5400
- 5' Sequencing 1 Primer
- AC5
- 5' Sequencing 1 Primer Sequence
- 5'd[ACACAAAGCCGCTCCATCAG]3'
- Tag 1
- V5 (Cterm), His (Cterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Constitutive insect cell expression. Can use pCoHygro or pCoBlast for selection.
- Catalog Number
- V411020
- Stable
- Unspecified
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral