Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pBAD102 Directional TOPO
Information
- Source/Vendor
- Invitrogen
- Alt Name
- pBAD102/D-TOPO
- Plasmid Type
- Bacterial Expression
- Promoter
- araBAD
- Expression Level
- Tightly controlled
- Cloning Method
- Unknown
- Size
- 4400
- 5' Sequencing 1 Primer
- pBad Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[ATGCCATAGCATTTTTATCC]3'
- Tag 1
- 6X His, V5
- Bacterial Resistance
- Ampicillin
- Notes
- Okay to use with Top10 OneShot comp cells
- Catalog Number
- K410201
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral