Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pBudCE4.1
| Source/Vendor: | Invitrogen |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Promotor: | CMV or EF-1a |
| Cloning Method: | Unknown |
| Size: | 4595 |
| 5' Sequencing 1 Primer: | CMVPro Fwd, EF1aPro Fwd |
| 5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3', 5'd[TCAAGCCTCAGACAGTGGTTC]3' |
| Bacterial Resistance: | Other |
| Selectable Marker: | Zeocin |
| Notes: | Dual expression in one plasmid |
| Catalog Number: | V53220 |
| Stable: | Unspecified |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |