Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pCAGGS-Svoboda
| Source/Vendor: | Svoboda lab |
| Alt Name: | pCAGGS |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Cloning Method: | Unknown |
| Size: | 5900 |
| 5' Sequencing 1 Primer: | 5': ggttcggcttctggcgtgtgacc |
| 5' Sequencing 1 Primer Sequence: | 3': TCC TTA AAC CTG TCT TGT AA |
| Bacterial Resistance: | Ampicillin |
| Notes: | This a modified version of the pCAGGS vector used by the Svoboda lab. |
| Stable: | Unspecified |
| Constitutive: | Unspecified |
| Viral/Non-Viral: | Unspecified |