Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pcDNA-DEST47
Source/Vendor: | Invitrogen |
Alt Name: | pDEST47 |
Analyze: | Sequence |
Plasmid Type: | Mammalian Expression |
Promotor: | CMV |
Expression Level: | High |
Cloning Method: | Unknown |
Size: | 7780 |
5' Sequencing 1 Primer: | T7 Fwd |
5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3' |
Tag 1: | GFP (Cterm) |
Bacterial Resistance: | Ampicillin |
Selectable Marker: | Neomycin |
Notes: | Easy to clone into other vectors |
Catalog Number: | 12281-010 |
Stable: | Transient |
Constitutive: | Constitutive |
Viral/Non-Viral: | Nonviral |