Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Vector Database


Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pcDNA3.1/Hygro(+)

Source/Vendor: Invitrogen
Alt Name: pcDNA 3.1 Hygro (+), pcDNA™3.1/Hygro(+)
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Cloning Method: Unknown
Size: 5597
5' Sequencing 1 Primer: T7 Fwd
5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'
Bacterial Resistance: Ampicillin
Selectable Marker: Hygromycin
Notes:
Differs from other pcDNA3.1 in drug resistance; +/- refers to orientation of f1 ori. Mammalian expression vector with the CMV promoter. The MCS is in the forward (+) orientation.
Catalog Number: V87020
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map

Loading...