Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pcDNA4/His C
Information
- Source/Vendor
- Invirtogen
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5096
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- 6X His, Xpress
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Zeocin
- Notes
- Easy to clone into other vectors.
- Catalog Number
- V86220
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral