Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pCMV-HA
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Cloning Method
- Unknown
- Size
- 3800
- 5' Sequencing 1 Primer
- pCMV
- 5' Sequencing 1 Primer Sequence
- 5'd[GATCCGGTACTAGAGGAACTGAAAAAC]3'
- Tag 1
- HA (Nterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Vector for expressing an N-terminally HA-tagged protein in mammalian cells.
- Catalog Number
- 631604
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral