Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pCRT7/NT-TOPO
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Bacterial Expression
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 2870
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- 6X His, Xpress
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Zeocin
- Catalog Number
- K420101
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral