Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pCTCON-2
Information
- Plasmid Type
- Yeast Expression
- Promoter
- GAL1
- Cloning Method
- Unknown
- Size
- 6394
- 5' Sequencing 1 Primer
- GAL1
- 5' Sequencing 1 Primer Sequence
- AATATACCTCTATACTTTAACGTC
- Tag 1
- HA, Myc
- Bacterial Resistance
- Ampicillin
- Notes
- Surface display plasmid
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified
Published Plasmid Map