Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pDEST24 Gateway
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Bacterial Expression
- Promoter
- n/a
- Expression Level
- Tightly controlled (use w/ BL21-AI)
- Cloning Method
- Unknown
- Size
- 7000
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- GST (Cterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Easy to clone into other vectors
- Catalog Number
- 12216016
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral