Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pDsRed-Express
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Bacterial Expression
- Promoter
- lac
- Cloning Method
- Unknown
- Size
- 3300
- 5' Sequencing 1 Primer
- DsRed
- 5' Sequencing 1 Primer Sequence
- 5'd[GTACTGGAACTGGGGGGACAG]
- Tag 1
- DsRed-Express
- Bacterial Resistance
- Ampicillin
- Notes
- Red fluorescent protein tag
- Catalog Number
- 632412
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified