Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pDsRed2-1
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Promoter
- none
- Cloning Method
- Unknown
- Size
- 4100
- 5' Sequencing 1 Primer
- DsRed1-N
- 5' Sequencing 1 Primer Sequence
- 5'd[GTACTGGAACTGGGGGGACAG]
- Bacterial Resistance
- Kanamycin
- Selectable Marker
- Neomycin
- Notes
- Red fluorescent protein reporter. Used to monitor transcription from cis-regulatory elements
- Catalog Number
- 632405
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral