Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pEF1-puro
Information
- Source/Vendor
- Springer lab
- Plasmid Type
- Mammalian Expression
- Promoter
- EF1a
- Cloning Method
- Unknown
- Size
- 7400
- 5' Sequencing 1 Primer
- EF1a-fwd, BGH-rev
- 5' Sequencing 1 Primer Sequence
- TCAAGCCTCAGACAGTGGTTC, TAGAAGGCACAGTCGAGG
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Puromycin
- Notes
- pEF1-puro is derived from pEF1/V5-HisA (Invitrogen) with the neomycin gene replaced with puromycin.
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified
Published Plasmid Map