Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pEGFP-C1
| Source/Vendor: | Clontech |
| Alt Name: | EGFP C1, pEGFPC1, EGFPC1 |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Promotor: | CMV |
| Expression Level: | High |
| Cloning Method: | Restriction Enzyme |
| Size: | 4731 |
| 5' Sequencing 1 Primer: | EGFP-C |
| 5' Sequencing 1 Primer Sequence: | CATGGTCCTGCTGGAGTTCGTG |
| 3' Sequencing 1 Primer: | SV40pA-R |
| 3' Sequencing 1 Primer Sequence: | GAAATTTGTGATGCTATTGC |
| Tag 1: | EGFP (N-term) |
| Bacterial Resistance: | Kanamycin |
| Selectable Marker: | Neomycin |
| Notes: | This plasmid has been discontinued by Clontech. For alternative plasmids with fluorescent tags, try plasmids from Doug Golenbock's Lab (http://www.addgene.org/browse/article/979/) or plasmids from Vladislav Verkhusha's Lab (http://www.addgene.org/browse/pi/1030/articles/). |
| Catalog Number: | discontinued |
| Stable: | Stable |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |