Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pEGFP-C2
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV
- Cloning Method
- Unknown
- Size
- 4700
- 5' Sequencing 1 Primer
- EGFP-C
- 5' Sequencing 1 Primer Sequence
- 5'd[CATGGTCCTGCTGGAGTTCGTG]
- Tag 1
- EGFP (Nterm)
- Bacterial Resistance
- Kanamycin
- Selectable Marker
- Neomycin
- Notes
- This plasmid has been discontinued by Clontech. For alternative plasmids with fluorescent tags, try plasmids from Doug Golenbock's Lab (http://www.addgene.org/browse/article/979/) or plasmids from Vladislav Verkhusha's Lab (http://www.addgene.org/browse/pi/1030/articles/).
- Catalog Number
- 6083-1
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral
Sequence
Published Plasmid Map