Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pEGFP-N1
| Source/Vendor: | Clontech |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Promotor: | CMV |
| Cloning Method: | Unknown |
| Size: | 4700 |
| 5' Sequencing 1 Primer: | CMV-F, EGFP-N |
| 5' Sequencing 1 Primer Sequence: | 5'd[CGTCGCCGTCCAGCTCGACCAG]3' |
| Tag 1: | EGFP (Cterm) |
| Bacterial Resistance: | Kanamycin |
| Selectable Marker: | Neomycin |
| Notes: | This plasmid has been discontinued by Clontech. For alternative plasmids with fluorescent tags, try plasmids from Doug Golenbock's Lab (http://www.addgene.org/browse/article/979/) or plasmids from Vladislav Verkhusha's Lab (http://www.addgene.org/browse/pi/1030/articles/). |
| Catalog Number: | 6085-1 |
| Stable: | Stable |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |