Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pET 11 b
Information
- Source/Vendor
- EMD Biosciences
- Plasmid Type
- Bacterial Expression
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 5700
- 5' Sequencing 1 Primer
- 5'd[TAATACGACTCACTATAGGG
- Bacterial Resistance
- Ampicillin
- Catalog Number
- 69436-3, 69437-3, 69438-3, 69439-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral