Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pET-20b(+)
Information
- Source/Vendor
- Novagen (EMD Millipore)
- Alt Name
- pET20b
- Plasmid Type
- Bacterial Expression
- Promoter
- AmpR, T7
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 3716
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- His (Cterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Bacterial vector for expressing proteins in the periplasm.
- Catalog Number
- 69739-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral