Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pET-23 a,b,c,d(+)
Information
- Source/Vendor
- Novagen/EMD Biosciences
- Plasmid Type
- Bacterial Expression
- Promoter
- AmpR, T7
- Expression Level
- High
- Cloning Method
- Unknown
- Size
- 3666
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Tag 1
- His (Cterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Same as pET21abcd(+) but no lac; a,b,c,d vary by MCS. Sequence & map shown are for pET-23a(+).
- Catalog Number
- 69745-3, 69746-3, 69747-3, 69748-3
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral