Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pET-28 b (+)
| Source/Vendor: | EMD Biosciences |
| Alt Name: | pET28b |
| Analyze: | Sequence |
| Plasmid Type: | Bacterial Expression |
| Expression Level: | High |
| Cloning Method: | Unknown |
| Size: | 5368 |
| 5' Sequencing 1 Primer: | T7 Fwd |
| 5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3' |
| Tag 1: | His (Nterm and Cterm) |
| Bacterial Resistance: | Kanamycin |
| Notes: | Nterm thrombin cleavage site; a,b,c vary by MCS; |
| Catalog Number: | 69865-3 |
| Stable: | Transient |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |