Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pET-30 Xa/LIC
Source/Vendor: | EMD Biosciences |
Analyze: | Sequence |
Plasmid Type: | Bacterial Expression |
Expression Level: | High |
Cloning Method: | Unknown |
Size: | 5400 |
5' Sequencing 1 Primer: | T7 Fwd |
5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3' |
Tag 1: | His (Nterm and Cterm), S-Tag (Cterm) |
Bacterial Resistance: | Ampicillin |
Notes: | For directional cloning of PCR-amplified DNA; ligation independent cloning; Factor Xa cleavage site |
Catalog Number: | 69073-3 (kit) |
Stable: | Transient |
Constitutive: | Constitutive |
Viral/Non-Viral: | Nonviral |