Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pET21a-LIC
| Source/Vendor: | Structural Genomics Consortium, Toronto |
| Plasmid Type: | Bacterial Expression |
| Promotor: | T7-lacO |
| Expression Level: | High |
| Cloning Method: | Unknown |
| Size: | 7170 |
| 5' Sequencing 1 Primer: | T7-Fwd |
| 5' Sequencing 1 Primer Sequence: | AATTAATACGACTCACTATAGGG |
| Tag 1: | His |
| Bacterial Resistance: | Ampicillin |
| Stable: | Unspecified |
| Constitutive: | Unspecified |
| Viral/Non-Viral: | Nonviral |
Published Plasmid Map
