Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pFLAG-CMV-1
Information
- Source/Vendor
 - Sigma
 - Alt Name
 - pFLAG-CMV1, pFLAGCMV1, pFLAG-CMV™-1
 - Plasmid Type
 - Mammalian Expression
 - Promoter
 - CMV
 - Expression Level
 - High
 - Cloning Method
 - Restriction Enzyme
 - Size
 - 4732
 - 5' Sequencing 1 Primer
 - CMV-F
 - 5' Sequencing 1 Primer Sequence
 - CGCAAATGGGCGGTAGGCGTG
 - 5' Sequencing 2 Primer
 - hGH-pA-R
 - 5' Sequencing 2 Primer Sequence
 - CCAGCTTGGTTCCCAATAGA
 - Tag 1
 - FLAG (N terminal)
 - Bacterial Resistance
 - Ampicillin
 - Notes
 - For transient expression with extracellular secretion of N-terminal FLAG fusion proteins. The Met-preprotrypsin leader sequence precedes the FLAG tag Vector for expression and secretion of N-terminally FLAG-tagged proteins in mammalian cells.
 - Catalog Number
 - E7273
 - Stable
 - Unspecified
 - Constitutive
 - Unspecified
 - Viral/Non-Viral
 - Unspecified