Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Vector Database


Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pFLAG-CMV-1

Source/Vendor: Sigma
Alt Name: pFLAG-CMV1, pFLAGCMV1, pFLAG-CMV™-1
Analyze: Sequence
Plasmid Type: Mammalian Expression
Promotor: CMV
Expression Level: High
Cloning Method: Restriction Enzyme
Size: 4732
5' Sequencing 1 Primer: CMV-F
5' Sequencing 1 Primer Sequence: CGCAAATGGGCGGTAGGCGTG
5' Sequencing 2 Primer: hGH-pA-R
5' Sequencing 2 Primer Sequence: CCAGCTTGGTTCCCAATAGA
Tag 1: FLAG (N terminal)
Bacterial Resistance: Ampicillin
Notes:
For transient expression with extracellular secretion of N-terminal FLAG fusion proteins. The Met-preprotrypsin leader sequence precedes the FLAG tag Vector for expression and secretion of N-terminally FLAG-tagged proteins in mammalian cells.
Catalog Number: E7273
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map

Loading...