Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pFLAG-CMV-1
| Source/Vendor: | Sigma |
| Alt Name: | pFLAG-CMV1, pFLAGCMV1, pFLAG-CMV™-1 |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Promotor: | CMV |
| Expression Level: | High |
| Cloning Method: | Restriction Enzyme |
| Size: | 4732 |
| 5' Sequencing 1 Primer: | CMV-F |
| 5' Sequencing 1 Primer Sequence: | CGCAAATGGGCGGTAGGCGTG |
| 5' Sequencing 2 Primer: | hGH-pA-R |
| 5' Sequencing 2 Primer Sequence: | CCAGCTTGGTTCCCAATAGA |
| Tag 1: | FLAG (N terminal) |
| Bacterial Resistance: | Ampicillin |
| Notes: | For transient expression with extracellular secretion of N-terminal FLAG fusion proteins. The Met-preprotrypsin leader sequence precedes the FLAG tag
Vector for expression and secretion of N-terminally FLAG-tagged proteins in mammalian cells. |
| Catalog Number: | E7273 |
| Stable: | Unspecified |
| Constitutive: | Unspecified |
| Viral/Non-Viral: | Unspecified |