Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pFLAG-CMV-1
Source/Vendor: | Sigma |
Alt Name: | pFLAG-CMV1, pFLAGCMV1, pFLAG-CMV™-1 |
Analyze: | Sequence |
Plasmid Type: | Mammalian Expression |
Promotor: | CMV |
Expression Level: | High |
Cloning Method: | Restriction Enzyme |
Size: | 4732 |
5' Sequencing 1 Primer: | CMV-F |
5' Sequencing 1 Primer Sequence: | CGCAAATGGGCGGTAGGCGTG |
5' Sequencing 2 Primer: | hGH-pA-R |
5' Sequencing 2 Primer Sequence: | CCAGCTTGGTTCCCAATAGA |
Tag 1: | FLAG (N terminal) |
Bacterial Resistance: | Ampicillin |
Notes: | For transient expression with extracellular secretion of N-terminal FLAG fusion proteins. The Met-preprotrypsin leader sequence precedes the FLAG tag
Vector for expression and secretion of N-terminally FLAG-tagged proteins in mammalian cells. |
Catalog Number: | E7273 |
Stable: | Unspecified |
Constitutive: | Unspecified |
Viral/Non-Viral: | Unspecified |