Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pGAPZ C
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Other, Pichia pastoris
- Promoter
- Glyceraldehyde-3-phosphate (Pgap)
- Cloning Method
- Unknown
- Size
- 2900
- 5' Sequencing 1 Primer
- 3'AOX1
- 5' Sequencing 1 Primer Sequence
- 5'd[GCAAATGGCATTCTGACATCC]3'
- Tag 1
- Myc (Cterm), His (Cterm)
- Bacterial Resistance
- Other
- Selectable Marker
- Zeocin
- Notes
- Expression and purification of protein from Pichia pastoris
- Catalog Number
- V20020
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral