Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pGEM-5Zf (-)
Information
- Source/Vendor
- Promega
- Alt Name
- pGEM5, pGEM5Z, pGEM5Zf
- Plasmid Type
- Bacterial Expression
- Cloning Method
- Unknown
- Size
- 3001
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Bacterial Resistance
- Ampicillin
- Notes
- Derived from the pGEM-3Zf(+) Vector and contain the origin of replication of the filamentous phage f1;Blue white Screening
- Catalog Number
- P2241; P2351
- GenBank
- X65309
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral