Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pGEX-4T-1
| Source/Vendor: | Amersham |
| Analyze: | Sequence |
| Plasmid Type: | Bacterial Expression |
| Promotor: | tac |
| Expression Level: | High (activate with IPTG) |
| Cloning Method: | Unknown |
| Size: | 4900 |
| 5' Sequencing 1 Primer: | pGEX Fwd |
| 5' Sequencing 1 Primer Sequence: | 5'd[GGGCTGGCAAGCCACGTTTGGTG]3' |
| Tag 1: | GST (Nterm) |
| Bacterial Resistance: | Ampicillin |
| Notes: | Thrombin cleavage site; can directly insert cDNA from lambda gt11 libraries |
| Catalog Number: | 27-4580-01 |
| Stable: | Transient |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |