Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pGEX-5X-2
Information
- Source/Vendor
- Amersham
- Plasmid Type
- Bacterial Expression
- Promoter
- tac
- Expression Level
- High (activate with IPTG)
- Cloning Method
- Unknown
- Size
- 4900
- 5' Sequencing 1 Primer
- pGEX Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'
- Tag 1
- GST (Nterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Factor Xa cleavage site
- Catalog Number
- 27-4585-01
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral