Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pGFPuv
Information
- Source/Vendor
- CLONTECH
- Plasmid Type
- Unspecified
- Cloning Method
- Unknown
- Size
- 3337
- 5' Sequencing 1 Primer
- lac_promoter
- 5' Sequencing 1 Primer Sequence
- CACTTTATGCTTCCGGCTCG
- Tag 1
- GFPuv
- Bacterial Resistance
- Ampicillin
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified