Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
This vector is not available from Addgene.
Plasmid: pGL3-Basic
Information
- Source/Vendor
- Promega
- Plasmid Type
- Luciferase
- Cloning Method
- Unknown
- Size
- 4818
- 5' Sequencing 1 Primer
- RVprimer3
- 5' Sequencing 1 Primer Sequence
- CTAGCAAAATAGGCTGTCCC
- Bacterial Resistance
- Ampicillin
- Notes
- Luciferase reporter vector. See http://www.promega.com/vectors/cloning_vectors.htm#b05 Promoterless vector for measuring the activity of promoter and enhancer sequences with a luciferase assay.
- Catalog Number
- E1751
- GenBank
- U47295
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral