Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pGL3-Enhancer
Information
- Source/Vendor
- Promega
- Plasmid Type
- Luciferase
- Promoter
- SV40
- Cloning Method
- Unknown
- Size
- 5064
- 5' Sequencing 1 Primer
- RVprimer3
- 5' Sequencing 1 Primer Sequence
- CTAGCAAAATAGGCTGTCCC
- Bacterial Resistance
- Ampicillin
- Notes
- Luciferase reporter vector. For more information, see http://www.promega.com/vectors/cloning_vectors.htm#b05 SV40 enhancer-containing vector for measuring the activity of promoter sequences with a luciferase assay.
- Catalog Number
- E1771
- GenBank
- U47297
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral