Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pGlow TOPO
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Mammalian Expression
- Cloning Method
- Unknown
- Size
- 5300
- 5' Sequencing 1 Primer
- T7 Fwd
- 5' Sequencing 1 Primer Sequence
- 5'd[TAATACGACTCACTATAGGG]3'
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Neomycin
- Notes
- Drives GFP expression
- Catalog Number
- K483001
- Stable
- Transient
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral