Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pHAT 10/11/12
Information
- Source/Vendor
- Clontech
- Plasmid Type
- Bacterial Expression
- Promoter
- lac
- Cloning Method
- Unknown
- Size
- 2800
- 5' Sequencing 1 Primer
- HAT
- 5' Sequencing 1 Primer Sequence
- 5'd[GAGGAGCACGCTCATGCCCAC]3'
- Tag 1
- HAT (Nterm)
- Bacterial Resistance
- Ampicillin
- Notes
- Histidine Affinity Tag (HAT) for purification
- Catalog Number
- 631205
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified