Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pIB/His
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Other
- Promoter
- OpIE2
- Cloning Method
- Unknown
- Size
- 3600
- 5' Sequencing 1 Primer
- OpIE2
- 5' Sequencing 1 Primer Sequence
- 5'd[CGCAACGATCTGGTAAACAC]3'
- Tag 1
- Xpress (N), His (N)
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- Blasticidin
- Notes
- Stable expression of gene in insect cells.
- Catalog Number
- V804001
- Stable
- Stable
- Constitutive
- Constitutive
- Viral/Non-Viral
- Nonviral