Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pIB/V5-His-TOPO
Source/Vendor: | Invitrogen |
Analyze: | Sequence |
Plasmid Type: | Other |
Promotor: | OpIE2 |
Cloning Method: | Unknown |
Size: | 3500 |
5' Sequencing 1 Primer: | OpIE2 |
5' Sequencing 1 Primer Sequence: | 5'd[CGCAACGATCTGGTAAACAC]3' |
Tag 1: | V5 (Cterm), His (Cterm) |
Bacterial Resistance: | Ampicillin |
Selectable Marker: | Blasticidin |
Notes: | Stable expression of gene in insect cells. Direct cloning of PCR products into vector. |
Catalog Number: | K89020 |
Stable: | Stable |
Constitutive: | Constitutive |
Viral/Non-Viral: | Nonviral |