Skip to main content

Vector Database


Welcome to Vector Database!

Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.

This vector is NOT available from Addgene and the database is no longer actively maintained.

This vector is not available from Addgene.

Plasmid: pICL

Information

Source/Vendor
ATCC
Plasmid Type
Unspecified
Cloning Method
Unknown
Size
8400
Notes
Deposited by: Gary G. Hermanson Restriction digests of the clone give the following sizes (kb): KpnI--6.3, 1.5, 0.6; SstI--8.4; BamHI--4.6, 3.8. (ATCC staff) TRP from pYAC4 is not really functional. (personal communication) Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones). [1] YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli. [1] Vector designed to rescue the CEN end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector. [1] Positive colonies should have the rescue plasmid integrated into the YAC clone near the ScaI site in the beta-lactamase (ampR) gene. [1] DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5'- GCGCTTAATGCGCCGCTACAGGGCG -3' and 5'- GCTCACCGGCTCCAGATTTATCAGC -3', complementary to the f1 ori and ampR sequences respectively. [1] Correctly integrated products will yield a 870 bp amplification product, that should be cleaved by PstI into two fragments: 705 bp and 165 bp. [1] The order of the major features of the rescue vector is: T7 promoter - SacI/polylinker/BamHI - LYS2 - XbaI - SphI - ScaI/ampR - pMB1 ori. [1] The order of the major features in a rcombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/SacI - CEN end YAC insert - EcoRI - CEN - ARS - (TRP) - ScaI/ampR - pMB1 ori. [1] Medium is 1227 LB plus ampicillin. Hosts: E.coli, E.coli HB101, E.coli XL-1-Blue, Saccharomyces cerevisiae. (Information source: VectorDB ( http://seq.yeastgenome.org/vectordb ).)
Catalog Number
77408
Stable
Unspecified
Constitutive
Unspecified
Viral/Non-Viral
Unspecified