Vector Database

Created by Moore, July 1995, under contract with NCBI. Deposited by: Judith L. Fridovich-Keil A promoter/enhancer-cloning shuttle vector using chloramphenicol acetyltransferase (CAT) as the reporter gene. [1] Promoter elements cloned into the polylinker may be sequenced using the following oligonucleotide primers: primer 1: 5'-TCCTTAGCTCCTGAAAATCT-3'; primer 2: 5'-AAACTCATCAATGTATCTTA- 3'. [1] Contains a trimer cassette of the SV40 major late polyadenylation signal to block background readthrough expression of the reporter gene. [1] The order of the major features in this phagemid is : HindIII - SV40 polyadenylation trimer - primer 2 site - BamHI/MCS/XhoI - primer 1 site - CAT gene - SV40 splice and polyadenylation signal - f1 ori - KpnI - SstI - ampR/pUC18. [1] The KpnI and SstI sites can be used for cloning enhancer elements. [1] Restriction digests of the clone give the following sizes (kb): HindIII--5.0, 0.75; EcoRI/HindIII--2.7, 2.0, 0.75, 0.3; XhoI--5.8. (ATCC staff) To avoid potential problems using primer 2, try the following primer sequence instead (assumes promoter inserted at or downstream of the SphI site): 5' TTATCATGTCTGGATCCAAG 3' (personal communication) Medium is 1227 LB plus ampicillin. Hosts: E.coli, E.coli HB101, vertebrate cells. Related vectors: pBLCAT3, pUC18, SV40. (Information source: VectorDB ( http://seq.yeastgenome.org/vectordb ).)