Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database


Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pJFCAT1

Source/Vendor: ATCC
Analyze: Sequence
Plasmid Type: Unspecified
Cloning Method: Unknown
Size: 5603
Notes:
Created by Moore, July 1995, under contract with NCBI. Deposited by: Judith L. Fridovich-Keil A promoter/enhancer-cloning shuttle vector using chloramphenicol acetyltransferase (CAT) as the reporter gene. [1] Promoter elements cloned into the polylinker may be sequenced using the following oligonucleotide primers: primer 1: 5'-TCCTTAGCTCCTGAAAATCT-3'; primer 2: 5'-AAACTCATCAATGTATCTTA- 3'. [1] Contains a trimer cassette of the SV40 major late polyadenylation signal to block background readthrough expression of the reporter gene. [1] The order of the major features in this phagemid is : HindIII - SV40 polyadenylation trimer - primer 2 site - BamHI/MCS/XhoI - primer 1 site - CAT gene - SV40 splice and polyadenylation signal - f1 ori - KpnI - SstI - ampR/pUC18. [1] The KpnI and SstI sites can be used for cloning enhancer elements. [1] Restriction digests of the clone give the following sizes (kb): HindIII--5.0, 0.75; EcoRI/HindIII--2.7, 2.0, 0.75, 0.3; XhoI--5.8. (ATCC staff) To avoid potential problems using primer 2, try the following primer sequence instead (assumes promoter inserted at or downstream of the SphI site): 5' TTATCATGTCTGGATCCAAG 3' (personal communication) Medium is 1227 LB plus ampicillin. Hosts: E.coli, E.coli HB101, vertebrate cells. Related vectors: pBLCAT3, pUC18, SV40. (Information source: VectorDB ( http://seq.yeastgenome.org/vectordb ).)
Catalog Number: 77317
Stable: Unspecified
Constitutive: Unspecified
Viral/Non-Viral: Unspecified

Generated Plasmid Map

Loading...