Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pKaede-MC1
Information
- Source/Vendor
- Amalgaam
- Plasmid Type
- Mammalian Expression
- Promoter
- CMV-F
- Cloning Method
- Unknown
- Size
- 4680
- 5' Sequencing 1 Primer
- CMV-F, SV40pA-R
- 5' Sequencing 1 Primer Sequence
- CGCAAATGGGCGGTAGGCGTG, GAAATTTGTGATGCTATTGC
- Tag 1
- Kaede
- Bacterial Resistance
- Kanamycin
- Selectable Marker
- Neomycin
- Stable
- Unspecified
- Constitutive
- Unspecified
- Viral/Non-Viral
- Unspecified
Published Plasmid Map