Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pKD4
| Source/Vendor: | Datsenko,K.A. and Wanner,B.L. |
| Analyze: | Sequence |
| Plasmid Type: | Other |
| Cloning Method: | Unknown |
| Size: | 3267 |
| 5' Sequencing 1 Primer: | Amp-R |
| 5' Sequencing 1 Primer Sequence: | ATAATACCGCGCCACATAGC |
| Bacterial Resistance: | Ampicillin |
| Selectable Marker: | Neomycin |
| Stable: | Unspecified |
| Constitutive: | Unspecified |
| Viral/Non-Viral: | Nonviral |