Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pLHCX
Source/Vendor: | Clontech |
Analyze: | Sequence |
Plasmid Type: | Retroviral |
Promotor: | CMV |
Cloning Method: | Unknown |
Size: | 6813 |
5' Sequencing 1 Primer: | LNCX |
5' Sequencing 1 Primer Sequence: | 5'd[AGCTCGTTTAGTGAACCGTCAGATC]3' |
Bacterial Resistance: | Ampicillin |
Selectable Marker: | Hygromycin |
Notes: | Retroviral expression
Retroviral vector for transient or stable constitutive expression of a gene. |
Stable: | Stable |
Constitutive: | Constitutive |
Viral/Non-Viral: | Retroviral |