Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pMSCVneo
Source/Vendor: | Clontech |
Alt Name: | MSCV neo (pmscv neo) |
Analyze: | Sequence |
Plasmid Type: | Retroviral |
Cloning Method: | Unknown |
Size: | 6500 |
5' Sequencing 1 Primer: | MSCV |
5' Sequencing 1 Primer Sequence: | 5'd[CCCTTGAACCTCCTCGTTCGACC]3' |
Bacterial Resistance: | Ampicillin |
Selectable Marker: | Neomycin |
Notes: | Retroviral vector optimized for expression of a gene in hematopoietic, embryonic stem, or embryonic carcinoma cells. |
Catalog Number: | 634401 |
Stable: | Stable |
Constitutive: | Constitutive |
Viral/Non-Viral: | Retroviral |