Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pMSCVpuro
| Source/Vendor: | Clontech |
| Alt Name: | MSCV pmscv puro |
| Analyze: | Sequence |
| Plasmid Type: | Retroviral |
| Promotor: | LTR |
| Cloning Method: | Unknown |
| Size: | 6300 |
| 5' Sequencing 1 Primer: | MSCV |
| 5' Sequencing 1 Primer Sequence: | 5'd[CCCTTGAACCTCCTCGTTCGACC]3' |
| Bacterial Resistance: | Ampicillin |
| Selectable Marker: | Puromycin |
| Notes: | Retroviral vector optimized for expression of a gene in hematopoietic, embryonic stem, or embryonic carcinoma cells. |
| Catalog Number: | K1062-1 |
| Stable: | Stable |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Retroviral |