Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database

Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pMSCVpuro

Source/Vendor: Clontech
Alt Name: MSCV pmscv puro
Analyze: Sequence
Plasmid Type: Retroviral
Promotor: LTR
Cloning Method: Unknown
Size: 6300
5' Sequencing 1 Primer: MSCV
5' Sequencing 1 Primer Sequence: 5'd[CCCTTGAACCTCCTCGTTCGACC]3'
Bacterial Resistance: Ampicillin
Selectable Marker: Puromycin
Retroviral vector optimized for expression of a gene in hematopoietic, embryonic stem, or embryonic carcinoma cells.
Catalog Number: K1062-1
Stable: Stable
Constitutive: Constitutive
Viral/Non-Viral: Retroviral

Generated Plasmid Map
