Vector Database
Welcome to Vector Database!
Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.
This vector is NOT available from Addgene and the database is no longer actively maintained.
Plasmid: pPIC9K
Information
- Source/Vendor
- Invitrogen
- Plasmid Type
- Other, Pichia pastoris
- Promoter
- AOX1
- Cloning Method
- Unknown
- Size
- 9300
- 5' Sequencing 1 Primer
- 3'AOX1
- 5' Sequencing 1 Primer Sequence
- 5'd[GCAAATGGCATTCTGACATCC]3'
- Bacterial Resistance
- Ampicillin
- Selectable Marker
- HIS3
- Notes
- Multicopy expression in Pichia strains
- Catalog Number
- V17520
- Stable
- Stable
- Constitutive
- Unspecified
- Viral/Non-Viral
- Nonviral